Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_074341.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_074341.1_at
GTTTATCATCTAGAAGGTGGAATTCTCAAATATCTGGAGGAGGTTCCAGAGACTCAGAGCCTTTGGGAGGGAGAGTGCTTTGTTTTTGACAAGCGAGTTT
CTGTGGAGCATGGTTTGGTTCAAGGAAATTTCAAGCTCTGCTATGGTTGTAAGCAGCCTGTGAGTGATGTTGACATGGAAGCCCCTGAATATGAATATGG
AGTCTCTTGTCCTTACTGTTTTGCACTGAAATCAGATGAAGAGAAGGAGAGGGCTCGAGCGCGACAACAACAGTTTGAGAGATGGGGAATCATAGGTGGT
CCAGATAAGGGTCGCCGGCCGGCAGCACGTGAATCGGATAGTGCTAGCAGGAAACCAAACCAGCTTTCACGTTCTGTT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_074341.1_at:823:669GAGGTTCCAGAGACTCAGAGCCTTT82366952Antisense
Ljwgs_074341.1_at:447:959TGACAAGCGAGTTTCTGTGGAGCAT44795999Antisense
Ljwgs_074341.1_at:130:1131TTCTGTGGAGCATGGTTTGGTTCAA1301131111Antisense
Ljwgs_074341.1_at:638:873GGAAATTTCAAGCTCTGCTATGGTT638873136Antisense
Ljwgs_074341.1_at:512:1041TAAGCAGCCTGTGAGTGATGTTGAC5121041162Antisense
Ljwgs_074341.1_at:1040:681GATGTTGACATGGAAGCCCCTGAAT1040681178Antisense
Ljwgs_074341.1_at:197:967TGAATATGGAGTCTCTTGTCCTTAC197967204Antisense
Ljwgs_074341.1_at:883:1155TTGTCCTTACTGTTTTGCACTGAAA8831155219Antisense
Ljwgs_074341.1_at:1127:517GCTCGAGCGCGACAACAACAGTTTG1127517265Antisense
Ljwgs_074341.1_at:170:983TCCAGATAAGGGTCGCCGGCCGGCA170983312Antisense
Ljwgs_074341.1_at:256:495GCCGGCAGCACGTGAATCGGATAGT256495330Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At2g40755: rhodanese like protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_074341.1 Lotus japonicus similar to At2g40755: rhodanese like protein
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr2.LjT31P23.20.r2.a
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma02g38340.1|PACid:16249455 9e-175 608 2e-173 606
Medicago truncatula IMGA|Medtr5g067730.1 Mtr.38833.1.S1_at Link; 0 732 0 745
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC