Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

chr1.CM0410.32_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>chr1.CM0410.32_at
ATGCCTCCTTCTTCTCCTTTCCTCTTCCCTCAAACCCAATCCACAGTCCTCCCAAACCCTTCAACCTTCTTCTCCCAAAACCTCCTCTCATCTCCACTCC
CCACAAACTCCTTCTTCCAAAACCTTGTCATCCAAAATGGTTCCCAACCTGAATACATTCACCCTTATCTCATCCAATCCTCAAACTCCTCCCTTTCTGC
CTCATACCCACTTCTCTTCTTCTCTGCAGCACTCTTATACCAAACCTTTGTTCCAGATCTCACAATCTCTTCCACTATCAAAACCTCAAATCCTCAAAAC
CATGTAATCTCATCTTACAGTGACCTTGGTGTCACATTAGACATCCCCAGTTCCAATTTGAGATTCTATCTAGCCAGAGGAAGCCCTTACATAACAGCCT
CAGTGACCAAACCAACACCACTTTCAATCACAACAGTTCACTCCATAGTGTCTCTGTTATCCGCTGCTGACAAAACCAAGCACACCCTTCAGCTCAATAA
CAATCAGACATGGCTAATATACTCTTCAGCCCCAATCAATTTAAATAAACATGGAAGCTCTGAGCTTCAATCTGACCCATTTTCTGGGGTGATTCGTATA
GCTGTTGTTCCTGATTCAACTTCAAACCCTAAGTATGAAGAAGTTCTTGACAAGTTCAGTTCTTGCTACCCTGTTTCTGGGGATGCAAAACTCAAGGGGA
ATTTCACCGTGGTGTATAAATGGCAGAGGAAAAATTCAGGGGATTTGCTCATGCTAGCTCACCCTCTTCATCTCAAGCTTCTCTCAAAAAACAAGCTTGC
TGCCACTGTTCTCTATGATTTCAAGTATAGAAGCGTTGATGGTGACCTTGTTGGTGTTGTTGGAGATTCATGGGTGTTGGAAGCTGAGCCTGTTCCTGTA
ACATGGCATTCTAACAGAGGAATCAAAAAAGAATCTTATGGGGAAATTGTTTCAGCACTTTTGAAAGATGTGAAGGAGCTGAATTATTCTGCAGTGGCAA
CAAATTCTTCTTATTTTTATGGGAAGCTTGTTGGAAGAGCTGCAAGGTTTGCATTGATAGCAGAAGAAGTTTCTTTCCCAAAAGTGATTCCAAAGATTGT
CAAGTTTCTGAAGGAGAGTATTGAGCCATGGTTGGATGGAACATTCAAAGGAAATGGCTTTCTCTATGAGACAAAATGGGGTGGGCTTGTTACTCAACAA
GGGTCCAAAGATGCAGGTGCTGATTTTGGGTTTGGGATTTACAATGATCACCATTTCCACTTGGGGTACTTTCTCTATGGAATTGCAGTTCTTGCAAAGA
TTGACCCTGCTTGGGGACAGAAATACAAGCCCCAAGCCTATGCACTTGTGAATGATTTCATGAACTTGGGACAAAGATACTACACTTTCTCTCCGCGGTT
ACGGTGTTTCGATCCTTACAAGATGCACTCTTGGGCCTCGGGGTTAACCGAGTTCGAAAATGGGAGGAATCAGGAAAGTACAAGTGAAGCTGTGAATGCT
TACTACTCAGCAGCATTGATGGGTCTAGCGTACGGCGACACACGTCTAGCTACCACTGGATCAACACTCACGGCACTGGAAATTGGTGCTACACAAATGT
GGTGGCATGTGAAAAAGGAACAAATTTTGTACCCAGAAGAATTTGCAGAAGATAACAGAATTGTGGGGATTCTTTGGGCTAACAAGAGAGACAGTAATCT
ATGGTGGGCTCCTGCTGAGTGCAGAGAATGCAGGTTAAGTATCCAAGTTCTACCATTGTTGCCTGTTACTGAATCTTTGTTCTCTGATGCTGGTTATGCT
AAGGAGCTTGTGGAGTGGACATTGCCTTCTTTGAAAAGCAAATCAAATGTAGAAGGGTGGAAGGGGTTTACCTATTCCTTGCAAGGGATTTATGATAAGG
AAATAGCATTGAAGAGTATAAGAATGTTGAAAGGTTTTGATGATGGGAACTCATACAGTAATCTGTTGTGGTGGATTCATAGCAGATAA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
chr1.CM0410.32_at:413:253AAAGATACTACACTTTCTCTCCGCG4132531385Antisense
chr1.CM0410.32_at:854:1053TACGGTGTTTCGATCCTTACAAGAT85410531412Antisense
chr1.CM0410.32_at:852:1117TTACAAGATGCACTCTTGGGCCTCG85211171428Antisense
chr1.CM0410.32_at:623:215ACTACTCAGCAGCATTGATGGGTCT6232151514Antisense
chr1.CM0410.32_at:163:679GATGGGTCTAGCGTACGGCGACACA1636791530Antisense
chr1.CM0410.32_at:707:231ACACGTCTAGCTACCACTGGATCAA7072311552Antisense
chr1.CM0410.32_at:418:855GGATCAACACTCACGGCACTGGAAA4188551570Antisense
chr1.CM0410.32_at:97:135AGTAATCTATGGTGGGCTCCTGCTG971351705Antisense
chr1.CM0410.32_at:509:315AAGTTCTACCATTGTTGCCTGTTAC5093151757Antisense
chr1.CM0410.32_at:929:729GTTGCCTGTTACTGAATCTTTGTTC9297291770Antisense
chr1.CM0410.32_at:498:421CTTTGTTCTCTGATGCTGGTTATGC4984211787Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At5g15870: putative protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
chr1.CM0410.200.nc Lotus japonicus similar to At5g15870: putative protein
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr1.CM0410.360.r2.m
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma18g50180.1|PACid:16311010 0 1019 0 1037
Medicago truncatula IMGA|Medtr7g013170.1 Mtr.31680.1.S1_at Link;Mtr.31681.1.S1_at Link;Mtr.42235.1.S1_at Link;Mtr.5715.1.S1_at Link; 0 1007 0 1011
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC