Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_099018.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_099018.1_at
ATTCGATCACCACCGCTTCCCTCCTCGACCACGGCAACTTCCCGGATCCCGACCCTTTCGGCGACGGCGACAGCGAAGACGGCGAGGATTTCGACGACGA
CTTCTCCGGCTTCGAGCCTCCCTCTGAGGAGGCGTACGAGGAGCCCGCGGTGGATGACAAAGACGTCGTCGTTCTGATTGAGCGGAACTTCACCACTGTC
GTCGAGAACAACCGGTTTGTCATGGTGGAGTTTTACGCTCCATGGTGCGGTCACTGTCAGTCTCTCGCGCCGGAGTACGCAGCCGCCGCCACTGAACTGA
AGAACGACGGTGTCGTTTTAGCTAAGGTGGATGCCACGCAGGAGAATGATTTGGCTCACGAGTACGATGTTCAGGGCTTCCCTACAGTGTCGTTCTTCAT
TGATGGGGTTCATAAGCCTTACACTGGCCAAAGAACCAAAGATGCTATAGTGACATGGATTAGGAAGAAGATAGGACCTGGTGTATACAACATAACTACG
TTGGATGATGCTGAGCGCATATTAACCTCTGAAAGTAAAGTTGTTTTGGGCTTCCTTGACTCTTTAGTT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_099018.1_at:433:497GCCCGCGGTGGATGACAAAGACGTC433497155Antisense
Ljwgs_099018.1_at:280:159AGACGTCGTCGTTCTGATTGAGCGG280159173Antisense
Ljwgs_099018.1_at:320:719GATTGAGCGGAACTTCACCACTGTC320719188Antisense
Ljwgs_099018.1_at:701:381CACTGTCGTCGAGAACAACCGGTTT701381206Antisense
Ljwgs_099018.1_at:517:457CGACGGTGTCGTTTTAGCTAAGGTG517457317Antisense
Ljwgs_099018.1_at:474:569GAATGATTTGGCTCACGAGTACGAT474569356Antisense
Ljwgs_099018.1_at:741:661GAGTACGATGTTCAGGGCTTCCCTA741661372Antisense
Ljwgs_099018.1_at:9:475CCTACAGTGTCGTTCTTCATTGATG9475393Antisense
Ljwgs_099018.1_at:508:847GGTTCATAAGCCTTACACTGGCCAA508847419Antisense
Ljwgs_099018.1_at:596:215ACTACGTTGGATGATGCTGAGCGCA596215507Antisense
Ljwgs_099018.1_at:1098:513GCTGAGCGCATATTAACCTCTGAAA1098513522Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At5g60640: protein disulfide isomerase precursor - like
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
chr3.CM0136.230.nd Lotus japonicus similar to At5g60640: protein disulfide isomerase precursor - like
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr3.CM0136.170.r2.a
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma11g20630.1|PACid:16284482 0 890 0 861
Medicago truncatula IMGA|Medtr4g059450.1 Mtr.8629.1.S1_at Link; 0 903 0 892
GO annotations
Go TermGo Name
Search Link GO:0006467 CCMG, DSBE cytochrome c biogenesis protein CcmG, thiol:disulfide interchange protein DsbE
Search Link GO:0006467 DSBD thiol:disulfide interchange protein DsbD
Search Link GO:0030508 TRXA thioredoxin 1
Search Link GO:0030508 TRXC thioredoxin 2
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeDescription
1.2.7.47 Search CCMG, DSBE cytochrome c biogenesis protein CcmG, thiol:disulfide interchange protein DsbE [COG:COG0526] [GO:0006467]
2.3.1.30 Search DSBA thiol:disulfide interchange protein DsbA [COG:COG0526]
2.3.1.32.2 Search DSBD thiol:disulfide interchange protein DsbD [EC:1.8.1.8] [COG:COG0526] [GO:0006467]
2.3.1.37.1 Search TRXC thioredoxin 2 [COG:COG0526] [GO:0030508]
2.3.1.72 Search TRXA thioredoxin 1 [COG:COG0526] [GO:0030508]
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC