Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_109730.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_109730.1_at
ATGAAGCTCCTTGAGAAGGATATTACCCTAAACCAGTCGGGTAGTGTGAAGGTGATTGCGGAAGACCCCGATGACTTATGGCTCCTCTACAACCTCATTT
CCAGTGGTGACACCGTCACCGCCGACACCACACGCAAGGTCCACCTCCAGTCATCCACCAAGAGCACAGCCGCATCACGCGTCAAGCTCACACTCCACCT
CAAGGTAACGCGCCGCGACTTCCACAAAGACTCCTCCACCCTCCGCATCCACGGCCGCAACCTCGAGCCCAACCAATATGTTTCTGCAGGATCCTTCCAC
ACGTTCACCCTCGAAACAAATAACCCCTTTGAGCTTCACAAGAAGCTATGGAACCCCCAAGCCATCGAAATCTTAAACGAAAGCACTAAAAATCTCACAT
GTTCTTCTGATTCTTCCAATGCTGACATTGTTGTTGTTCCTCTTCAACAAAACCAAGCTGAGATATACTTGCTTACAAAAGGGATTACCACACGTTGTTC
CAAGGTTGAAGCTTCACCATCTTCTTCACATTCACAAGCACTGAGAAAAGCTTCCTTTAACGTGTTCTTCCGTGAAGTTTTTGTCGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_109730.1_at:495:717GATTGCGGAAGACCCCGATGACTTA49571766Antisense
Ljwgs_109730.1_at:109:685GATGACTTATGGCTCCTCTACAACC10968582Antisense
Ljwgs_109730.1_at:857:235ACAACCTCATTTCCAGTGGTGACAC857235101Antisense
Ljwgs_109730.1_at:319:155AGAGCACAGCCGCATCACGCGTCAA319155173Antisense
Ljwgs_109730.1_at:439:299AAGCTCACACTCCACCTCAAGGTAA439299196Antisense
Ljwgs_109730.1_at:656:1041TAACGCGCCGCGACTTCCACAAAGA6561041218Antisense
Ljwgs_109730.1_at:843:287AACCTCGAGCCCAACCAATATGTTT843287271Antisense
Ljwgs_109730.1_at:426:351AATATGTTTCTGCAGGATCCTTCCA426351287Antisense
Ljwgs_109730.1_at:885:377CACACGTTCACCCTCGAAACAAATA885377310Antisense
Ljwgs_109730.1_at:764:241AAATAACCCCTTTGAGCTTCACAAG764241330Antisense
Ljwgs_109730.1_at:731:1029TCACATGTTCTTCTGATTCTTCCAA7311029407Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At4g27650: pelota (PEL1)
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_109730.1 Lotus japonicus similar to At4g27650: pelota (PEL1)
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr1.CM0012.2490.r2.a
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma19g37250.1|PACid:16314064 4e-126 447 1e-125 447
Medicago truncatula IMGA|Medtr7g102760.1 3e-145 511 2e-141 498
GO annotations
Go TermGo Name
Search Link GO:0003747 peptide chain release factor
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeDescription
2.2.2.3 Search peptide chain release factor [GO:0003747]
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC