Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_033095.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_033095.1_at
CTTTATTCATAACAATAATCACTATTTTGAACTTGGGAGAGGTTGGAAAACTTATTTTTTCTCTAACTTTTTACCGTGCAGGATTGTCAGTGAAATTCTC
AGTAATAAGAGTCCGTTCAACGACGGCGACGCCCAGGATGGAGTCCAATGGGCCTTGAGCCCAGCCGGGAGCTTCACTGCCAGAACCGCTCACGACCTTA
TCTCTCCATCGTTACACCGTCGCTTAGATGATAATTTATGGAAGGTAGTTTGGAAAATTAAAGGACCCCAGAGGGTGCGTGTGTTTCTCTGGAAATTATT
GAATAACGGGGTGCTCACCAATGTCGCTCGAGTTCGTCGTCACATGGGATCATCTAATGTATGTCCTCTCTATCAAAGTGCGGCCGAAACTTTGATACAT
TTGTTCCGTGATTGCAGTGCCATTGCACCTTTTTGGGTTGCTGCTTTATCTACGGTTAGTCCCTCTGCTTTCTTCACTGCAAATTGGCATGTTTGGTCTT
TAGGTAATATCACTGGCAGGTTCATGGATGGCTCGAATCTGGACTAGCCTCGCTTCTTCGCGACGGCACTCTCGGCGATTTGGCGAATGCGAAACGAGCT
CGTCTTCAATGGTACTCCGCACAGCCCCTCGCGTATTTGGAGGTTTATTCGTTCCTTGGGAATGGAAGAGATCGCATCATATGGGTTATCGTCCTCGCTG
AATGTGTTACAAGGCTAGCCGTTGGACGTGTTCGGGAGGGGAGGTTCGCGTGCCAGGTCTCACCATTGGACAAGGCTACCCGAGGGTTGGATTAAGGCCA
ATGTTGATGGAGCACTCAGCAGTGAGCTCCAGGCCAGCTGTGGAGGGGTATTTCACGACGCTGCAGGTTCGTGGTCGAAAGGGTTCAGTCGAAACCTTGG
AGGCCTACATTGGCATATACTTTCTTTGTTGAGCTTATGGTTGTGCAAGCTGCAATGGATTTCATTATCAGCTGGGAAATTTCTCCAGTTATTATTGAAA
GTGACTTTCACTAAGTGGTTGAGCTGTTGCAGGATTGTAATGCTTCCTCCTCACACCAATATGGTGAGATTGCCTGGGATATTCTACAGAAGATATCAGA
CCATGGTTTAATTGTGATTCAAAATATTCCAAGGGAAGCTAACTCTTTGGCGAACTACCTTGCTAAGGTGGGCTTATCTCTTCCATTTGGAATGCATTCT
TTTGAAGTGTCGTTTGGCGAGTGACACTTATTGTTGCAGAA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_033095.1_at:511:535GCATCATATGGGTTATCGTCCTCGC511535686Antisense
Ljwgs_033095.1_at:707:61ATCGTCCTCGCTGAATGTGTTACAA70761700Antisense
Ljwgs_033095.1_at:85:237ACAAGGCTAGCCGTTGGACGTGTTC85237721Antisense
Ljwgs_033095.1_at:602:785GTGCCAGGTCTCACCATTGGACAAG602785762Antisense
Ljwgs_033095.1_at:769:1ATTGGACAAGGCTACCCGAGGGTTG7691777Antisense
Ljwgs_033095.1_at:1066:823GGGTATTTCACGACGCTGCAGGTTC1066823858Antisense
Ljwgs_033095.1_at:1125:131AGTCGAAACCTTGGAGGCCTACATT1125131899Antisense
Ljwgs_033095.1_at:974:889GGCATATACTTTCTTTGTTGAGCTT974889924Antisense
Ljwgs_033095.1_at:1023:539GCAGGATTGTAATGCTTCCTCCTCA10235391041Antisense
Ljwgs_033095.1_at:160:173AGCTAACTCTTTGGCGAACTACCTT1601731149Antisense
Ljwgs_033095.1_at:130:1039TAAGGTGGGCTTATCTCTTCCATTT13010391176Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus hypothetical protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_033095.1 Lotus japonicus hypothetical protein
Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
Go TermGo Name
Search Link GO:0003721 RNA-directed DNA polymerase
Search Link GO:0003964 RNA-directed DNA polymerase
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeDescription
2.4.3.9 Search E2.7.7.49 RNA-directed DNA polymerase [EC:2.7.7.49] [COG:COG3344] [GO:0003721 0003964]
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC