Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_059217.1_s_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_059217.1_s_at
TCATGATTTCTCCTGTGGTTGAGCAAGGAAAAACAGAAGTTAAAGCACTCTTTCCTCCTGGAACGTGGTACAGTTTGTTTGATATGACACAAACCATTGT
TTCAAAAGATGGAGCCTATGTTACCCTTGATGCACCACTTCATGTGGTTAATGTGCATTTGTATCAGAATGCTATTCTTCCAATGCAACAAGGCGGAGTG
ACAACTAAGGATGCTAGAATGACACCCTTCAGCCTCATTGTGACTTTTCCAGCTGATGCTGCTGAAGGAGAAGCTAAAGGGAACCTGTTCATTGATGATG
ATGAGCATCCAGAAATGAAGCTTGGAAATGGCTTTTCAAGCTACATTGATTTCCAAGCAACTGTGAAAGAAGGAAGTGTGAAAGTTTGGTCAGAAGTTCA
AGATGGAAAGTTTGCTTTAGATAAAGGTTGGGTTATTGACACCATAAATGTGTTGGGATTAAGTGGAAGAAGTGAAACATTAGCTACAATTGAGATTGAT
GGAGAACCACCAAGGGGTGTCTCAGATGTGAAAGTTAGTGCATCTGAACATAAGTACTTGTATGGTCAGGAAGATGGAGAAAAGAAGATAGTGATGGTAG
GATTGAAGGGTCTAAATATCCCTGTAGGTAAAAAATTTGCTTTGACTTGGAAGGTGGGATCA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_059217.1_s_at:541:959TGACACAAACCATTGTTTCAAAAGA54195997Antisense
Ljwgs_059217.1_s_at:756:375CAAACCATTGTTTCAAAAGATGGAG756375102Antisense
Ljwgs_059217.1_s_at:1088:937TGTTACCCTTGATGCACCACTTCAT1088937131Antisense
Ljwgs_059217.1_s_at:751:1115TTACCCTTGATGCACCACTTCATGT7511115133Antisense
Ljwgs_059217.1_s_at:437:199ACCCTTGATGCACCACTTCATGTGG437199135Antisense
Ljwgs_059217.1_s_at:322:479CCTTGATGCACCACTTCATGTGGTT322479137Antisense
Ljwgs_059217.1_s_at:224:1149TTGATGCACCACTTCATGTGGTTAA2241149139Antisense
Ljwgs_059217.1_s_at:1139:415CTTCATGTGGTTAATGTGCATTTGT1139415150Antisense
Ljwgs_059217.1_s_at:132:1023TCATGTGGTTAATGTGCATTTGTAT1321023152Antisense
Ljwgs_059217.1_s_at:311:535GCATTTGTATCAGAATGCTATTCTT311535167Antisense
Ljwgs_059217.1_s_at:582:935TGTATCAGAATGCTATTCTTCCAAT582935172Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to Q9ZP04: (Q9ZP04) ALPHA-D-XYLOSIDASE PRECURSOR
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_059217.1 Lotus japonicus similar to Q9ZP04: (Q9ZP04) ALPHA-D-XYLOSIDASE PRECURSOR
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
LjSGA_059217.1
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC