Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

chr6.CM0114.16_at Predicted as a transcription factor  Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>chr6.CM0114.16_at
ATGGCGCCGAGGGATAAGACCAACGCCGTGAAGGTGAGCGGAAACGGAAACGGTAACGGCAACGGCGGCGTTAAGGAGGTGCATTTTAGAGGAGTTAGAA
AGAGGCCATGGGGGAGATACGCTGCCGAGATCCGAGATCCCGGCAAGAAGAGCCGCGTCTGGCTCGGAACATTTGACACGGCGGAAGAGGCGGCGCGTGC
ATACGACACCGCCGCAAGAGAGTTTCGCGGCCCCAAGGCCAAAACCAACTTCCCTTTCCCTTCAGACAATGTCAAGAACCAGAGCCCGAGCCAGAGCAGT
ACCGTTGAGTCTTCCAGCCGCGACCGTGACGTTGCTGCTGCCGCTGATTCATCGTCTCTTGATCTCAACTTGGCACCTTCCGTTCGGTTTCCTTTCCGTC
CCCAGTTCCCGCAGATGCCGGCGGCGAACCAGGTGCTGTTCTTCGACGCGATTCTGCGTGCCGGCATGGTGGGTGGTTCCCCTGCCTCCCAACGCTACGG
TTTCGATTTTCACACCTACAATCATCCCGTGGCGGCGAGTGAGATCCAGGCGGTGGCCGGAGCCCAGAGCGACTCAGACTCGTCCTCGGTGATCGATCTG
AACCACTATGAAAGCGGTGTTGTTATAAAAGCTGGTGGTAGAAACTTTGATCTCGACCTTAACTACCCTCCAATGGAAGACATGGCTTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
chr6.CM0114.16_at:526:145AGATACGCTGCCGAGATCCGAGATC526145127Antisense
chr6.CM0114.16_at:1003:303AAGAAGAGCCGCGTCTGGCTCGGAA1003303157Antisense
chr6.CM0114.16_at:576:311AAGAGGCGGCGCGTGCATACGACAC576311197Antisense
chr6.CM0114.16_at:19:91ATGTCAAGAACCAGAGCCCGAGCCA1991281Antisense
chr6.CM0114.16_at:347:155AGAGCAGTACCGTTGAGTCTTCCAG347155305Antisense
chr6.CM0114.16_at:683:943TGATTCATCGTCTCTTGATCTCAAC683943357Antisense
chr6.CM0114.16_at:704:835GGTGCTGTTCTTCGACGCGATTCTG704835444Antisense
chr6.CM0114.16_at:822:501GCTACGGTTTCGATTTTCACACCTA822501506Antisense
chr6.CM0114.16_at:1133:237ACAATCATCCCGTGGCGGCGAGTGA1133237530Antisense
chr6.CM0114.16_at:1132:693GATCGATCTGAACCACTATGAAAGC1132693603Antisense
chr6.CM0114.16_at:1125:805GTGGTAGAAACTTTGATCTCGACCT1125805647Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to Q9ZR83: (Q9ZR83) EREBP-3 HOMOLOG
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
chr6.CM0114.120.nc Lotus japonicus similar to Q9ZR83: (Q9ZR83) EREBP-3 HOMOLOG
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr6.CM0114.580.r2.m
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma13g30990.1|PACid:16292177 9e-68 252 6e-63 237
Medicago truncatula IMGA|Medtr2g014340.1 Mtr.26364.1.S1_at Link; 3e-63 237 1e-64 242
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
Family: AP2
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC