Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

msl5859_s_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>msl5859_s_at
ATGACGATGGCCGTGACGAAGTTACGTGTCGAGGAGAAGCTTTATCAGAACCGCTATCTGGTCGATCCGGGCCGCCCGCATATCAAAGTGCGACCGCACG
AGAGGCCGAGCGCGAACCTGCTCGCGCTGACACACATCTGCCCGGCCAAATGCTATGAGTTGAACGACAAGGGACAGGTGGAGACCACTTCCGACGGCTG
CATGGAATGCGGCACCTGTCGCGTGCTGTGCGAGGCCAGCGGTGAGATCGTGTGGAATTACCCGCGCGGCGGCTTCGGCGTTCTCTTCAAGTTCGGATGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
msl5859_s_at:962:79ATGACGATGGCCGTGACGAAGTTAC9627913Antisense
msl5859_s_at:381:649GAGAAGCTTTATCAGAACCGCTATC38164946Antisense
msl5859_s_at:574:49ATCAGAACCGCTATCTGGTCGATCC5744956Antisense
msl5859_s_at:786:811GGGCCGCCCGCATATCAAAGTGCGA78681181Antisense
msl5859_s_at:629:47ATCAAAGTGCGACCGCACGAGAGGC6294794Antisense
msl5859_s_at:527:203ACGAGAGGCCGAGCGCGAACCTGCT527203110Antisense
msl5859_s_at:728:973TGCTATGAGTTGAACGACAAGGGAC728973163Antisense
msl5859_s_at:550:613GACAAGGGACAGGTGGAGACCACTT550613178Antisense
msl5859_s_at:224:807GTGGAGACCACTTCCGACGGCTGCA224807190Antisense
msl5859_s_at:1158:219ACTTCCGACGGCTGCATGGAATGCG1158219199Antisense
msl5859_s_at:445:895GGCTGCATGGAATGCGGCACCTGTC445895208Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Database error. No record found.
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
No gene mapped to this probeset using this criteria.Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC