Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

gi45618624_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>gi45618624_at
TGAGTTGTGTGCAAATTGGGGATGACAGACTGTGATGATGTGTTGCACATGTTGGCTGAATTGAGAATGCATGGGTGCTGAATGATGATGTTATGAACGC
AGTTGGATGCCTGAAAAAAAAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
gi45618624_at:178:791GTGCAAATTGGGGATGACAGACTGT17879121Antisense
gi45618624_at:105:391CAGACTGTGATGATGTGTTGCACAT10539138Antisense
gi45618624_at:965:679GATGTGTTGCACATGTTGGCTGAAT96567949Antisense
gi45618624_at:10:929TGTGTTGCACATGTTGGCTGAATTG1092951Antisense
gi45618624_at:391:799GTGTTGCACATGTTGGCTGAATTGA39179952Antisense
gi45618624_at:684:727GTTGCACATGTTGGCTGAATTGAGA68472754Antisense
gi45618624_at:69:969TGCACATGTTGGCTGAATTGAGAAT6996956Antisense
gi45618624_at:807:399CATGTTGGCTGAATTGAGAATGCAT80739960Antisense
gi45618624_at:325:1149TTGAGAATGCATGGGTGCTGAATGA325114973Antisense
gi45618624_at:160:569GAATGCATGGGTGCTGAATGATGAT16056977Antisense
gi45618624_at:624:971TGCATGGGTGCTGAATGATGATGTT62497180Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
BP061876 Lotus corniculatus var. japonicus mature nodule Lotus corniculatus var. japonicus cDNA clone GENf083b04 3 , mRNA sequence reverse complement
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
BP061876 Lotus corniculatus var. japonicus mature nodule Lotus corniculatus var. japonicus cDNA clone GENf083b04 3 , mRNA sequence reverse complement
Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC