Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

mlr2659_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>mlr2659_at
ATGAACAGAATTTTCAAGACAGCCGTGCTGTCCGCCGCCATGGCCGCCACCATGCTTGTGGCCTTGCCCGCGGCCAACGCCGATGAATGGCGCCATCACC
GCCACCACGGCAATGGCGACGCCATTGCCGCCGGTGTGCTTGGCCTCGCCGCCGGCGCCCTGATCGGTGGCGCGCTGGCCAATGACCAGCCACCGCCTGA
CGCTGACCGCTACTACGATGACGGTTACTACGATCGTGACGTGCGTATCCGCCCGGCACCGGTCCGCCGCTACTATGTCGAACCGCGGGTGGTCTATGCC
GATCGCTATGCCGAGCCGTGGACGCGTGACTGGTACGAATACTGCTCGGACCGCTACCGCAGCTTCAACTCCCGCACCGGGACCTTCACCGGCAATGACG
GCGAGCAGCATTTCTGCACGGCAAACTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
mlr2659_at:49:169AGAATTTTCAAGACAGCCGTGCTGT4916919Antisense
mlr2659_at:669:901GGCCAACGCCGATGAATGGCGCCAT66990184Antisense
mlr2659_at:308:523GCTACTACGATGACGGTTACTACGA308523221Antisense
mlr2659_at:795:215ACTACGATCGTGACGTGCGTATCCG795215239Antisense
mlr2659_at:520:521GCTACTATGTCGAACCGCGGGTGGT520521281Antisense
mlr2659_at:396:507GCGGGTGGTCTATGCCGATCGCTAT396507297Antisense
mlr2659_at:933:693GATCGCTATGCCGAGCCGTGGACGC933693313Antisense
mlr2659_at:389:469CCGTGGACGCGTGACTGGTACGAAT389469328Antisense
mlr2659_at:729:837GGTACGAATACTGCTCGGACCGCTA729837344Antisense
mlr2659_at:5:885GGCAATGACGGCGAGCAGCATTTCT5885403Antisense
mlr2659_at:541:543GCAGCATTTCTGCACGGCAAACTGA541543417Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Database error. No record found.
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
No gene mapped to this probeset using this criteria.Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC