Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

chr5.CM0909.59_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>chr5.CM0909.59_at
ATGGAGGATGATGTTAAGGTTTTTGGTCTATGGGCAAGTCCATATACCCAGAGGGTTATATGGGCACTAAAATTAAAGGGTGTGACTTATGAGTACATTG
GGGAAGATCTAGCAAACAAGAGCAACCTGTTATTGCAATACAATCCCATCTACAAGAAGGTTCCTGTTCTTGTACATAATGGAAAACCAGTAGCAGAGTC
AATGGTCATTCTTCAATACATTGACGAGACATGGCCTCAGATCCCTCTTATGCCCCAAGACGCTAAAGAGAGATCCAATGTTCGTTTTTGGTCAAAATTC
ATCGATGAAGCGACAACGCACCTTATCGAATTTTTCCGGTATGATGGAGAAAAACACGAGAGGGAAATGAAAGAGATTTGGGAAGCTTTGAGACTCATAG
AAAAAGAAAGTGGACTTGGTAAAAAGAAATTCATTGGTGGCAACACCATAGGATTGGCAGACCTTGCCTTGGGATGGGTTGCTCATACTCTGGTGGCCAT
GGAAGAGGTGATTGGAGTCAAGTTCATCACTGCTGAAGAGTTTCCTCACCTTCACTCATGGATAGGGAATTTCTTGGCAACTCCTGCTATAAAAGACAAT
CTCCCATCTCATGAGCTAGCAGTTGAGTATTTCAAAGAAAAGAGGAAGATGTGTCTTGCAATATTTGCTACCCAACCTTGTCACCACCATCACTAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
chr5.CM0909.59_at:100:343AATCCCATCTACAAGAAGGTTCCTG100343154Antisense
chr5.CM0909.59_at:561:543GCAGAGTCAATGGTCATTCTTCAAT561543205Antisense
chr5.CM0909.59_at:218:7ATTGACGAGACATGGCCTCAGATCC2187232Antisense
chr5.CM0909.59_at:794:1109TTATGCCCCAAGACGCTAAAGAGAG7941109260Antisense
chr5.CM0909.59_at:340:585GAAGCGACAACGCACCTTATCGAAT340585319Antisense
chr5.CM0909.59_at:479:157AGACCTTGCCTTGGGATGGGTTGCT479157471Antisense
chr5.CM0909.59_at:542:95ATGGGTTGCTCATACTCTGGTGGCC54295486Antisense
chr5.CM0909.59_at:123:735GTTCATCACTGCTGAAGAGTTTCCT123735534Antisense
chr5.CM0909.59_at:1095:1137TTCCTCACCTTCACTCATGGATAGG10951137554Antisense
chr5.CM0909.59_at:934:23ATTTCTTGGCAACTCCTGCTATAAA93423581Antisense
chr5.CM0909.59_at:402:345AATCTCCCATCTCATGAGCTAGCAG402345610Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to Q9FQE0: (Q9FQE0) GLUTATHIONE S-TRANSFERASE GST 18 (EC 2.5.1.
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
chr5.CM0909.260.nc Lotus japonicus similar to Q9FQE0: (Q9FQE0) GLUTATHIONE S-TRANSFERASE GST 18 (EC 2.5.1.
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr5.CM0909.260.r2.m
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma13g19130.1|PACid:16290802 4e-58 220 1e-57 220
Medicago truncatula IMGA|Medtr1g090150.1 Mtr.6489.1.S1_at Link; 6e-103 369 9e-103 369
GO annotations
Go TermGo Name
Search Link GO:0004364 gst glutathione S-transferase
Search Link GO:0016034 E5.2.1.2, maiA maleylacetoacetate isomerase
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeDescription
1.11.10.4 Search E5.2.1.2, maiA maleylacetoacetate isomerase [EC:5.2.1.2] [COG:COG0625] [GO:0016034]
1.5.12.8 Search E5.2.1.2, maiA maleylacetoacetate isomerase [EC:5.2.1.2] [COG:COG0625] [GO:0016034]
1.6.9.16.1 Search GST glutathione S-transferase [COG:COG0625]
2.3.1.70 Search SSPA stringent starvation protein A [COG:COG0625]
3.2.2.120 Search E2.5.1.18, gst glutathione S-transferase [EC:2.5.1.18] [COG:COG0625] [GO:0004364]
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC