Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

mlr2143_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>mlr2143_at
ATGACCGGGCTTGCCGACGCCACGGTGTTGATCGTGCGCCATGGCGAAAAGCCCGACAGCGGCCCGGGCCTGTCGCCCGAAGGCGAAGCCCGCGCGCAGG
CCTATGTCGCCTATTTCCAGCCCTTCATGCTGGACGGCGTCGCCTTCCGGCCCGATATGCTGGTGGCCAGCACCGATTCCAAGAACAGCGCACGCGAGCG
GCTGACGCTCACCCCGCTCAGCCAGGCGCTGAAACTCCCCATTGACCAGCGCTTCGCCGACAAGGACGTCAAAGCCCTCGTCGCGGCACTCTCCAGCGAA
ACCCACGGCAAGTCGATCCTGATCGCCTGGCATCACGGCCAGCTGGGAAAACTCATCAAGGCCTTCGGCGCCGACCCGCAGGCCCTGCTGCCGAACGGCA
AATGGCCCGGCGATGTCTTCAACTGGGTGGTCGTGCTGCGCTTCGATCAGGCCGGGCACCTGGTGCCGGGCTCGGCGCGGATTATTGAGGAGAAGTTGCC
AGGGTAG

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
mlr2143_at:221:1141TTGCCGACGCCACGGTGTTGATCGT221114123Antisense
mlr2143_at:341:787GTGCGCCATGGCGAAAAGCCCGACA34178746Antisense
mlr2143_at:1117:921TGGTGGCCAGCACCGATTCCAAGAA1117921173Antisense
mlr2143_at:722:717GATTCCAAGAACAGCGCACGCGAGC722717187Antisense
mlr2143_at:1017:183AGCGCTTCGCCGACAAGGACGTCAA1017183260Antisense
mlr2143_at:375:311AAGGACGTCAAAGCCCTCGTCGCGG375311274Antisense
mlr2143_at:213:319AAGTCGATCCTGATCGCCTGGCATC213319322Antisense
mlr2143_at:379:889GGCATCACGGCCAGCTGGGAAAACT379889341Antisense
mlr2143_at:730:875GGAAAACTCATCAAGGCCTTCGGCG730875358Antisense
mlr2143_at:398:247AAATGGCCCGGCGATGTCTTCAACT398247412Antisense
mlr2143_at:933:773GTCTTCAACTGGGTGGTCGTGCTGC933773427Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Database error. No record found.
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
No gene mapped to this probeset using this criteria.Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC