Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_056101.2_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_056101.2_at
ATGGCTGCCATGAACTCTAGCGTGTTGGCTTGTGGCTATGCCATATCTGGTGCAGGATGTTCTGAGCTCAATTCAAAGCTCACCTCCATGCCCTCTTTGA
CTGTCTCTGGCTCCAAGTTGCCCGTGATCAAGGCCCGCAGCCGAGTAACTGAGCACAAAGCATGTGATGGAAGGAGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_056101.2_at:712:479CCATGAACTCTAGCGTGTTGGCTTG71247920Antisense
Ljwgs_056101.2_at:1088:281AACTCTAGCGTGTTGGCTTGTGGCT108828125Antisense
Ljwgs_056101.2_at:1051:721GTTGGCTTGTGGCTATGCCATATCT105172136Antisense
Ljwgs_056101.2_at:1011:69ATGCCATATCTGGTGCAGGATGTTC10116950Antisense
Ljwgs_056101.2_at:615:59ATCTGGTGCAGGATGTTCTGAGCTC6155957Antisense
Ljwgs_056101.2_at:1030:395CAGGATGTTCTGAGCTCAATTCAAA103039565Antisense
Ljwgs_056101.2_at:188:179AGCTCAATTCAAAGCTCACCTCCAT18817977Antisense
Ljwgs_056101.2_at:629:71ATGCCCTCTTTGACTGTCTCTGGCT62971100Antisense
Ljwgs_056101.2_at:204:1091TTTGACTGTCTCTGGCTCCAAGTTG2041091108Antisense
Ljwgs_056101.2_at:710:907TGGCTCCAAGTTGCCCGTGATCAAG710907120Antisense
Ljwgs_056101.2_at:249:485CCAAGTTGCCCGTGATCAAGGCCCG249485125Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At5g64040: photosystem I reaction centre subunit psaN precursor (PSI-N) (sp|P49107)
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_056101.2 Lotus japonicus similar to At5g64040: photosystem I reaction centre subunit psaN precursor (PSI-N) (sp|P49107)
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
LjSGA_056101.2
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC