Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

chr2.CM0099.18.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>chr2.CM0099.18.1_at
ATGTTGAGACGTGGACACAAATCAAAGCTATGGAATTCACGGGTACCTGTGCTTGCCATTTCTCTTGCATTTATGCTAGTGCTAGTGATTCTCTTTCTAG
TTCTTCATAATGACAGTGATGGTGAAAAACCCAGTTTAGCTTATGAAGTTTCTGAACAAAAATGGAGTAGCTTTGACTCTTTGGTGAAATTGCATCCAAC
AAGAGAGTTCAGGAATGGAACTGATTTGATATGGCAAGTACCTGAATCACCTAAAGGTGTTATGTTTTTAGCTCATGGATGCAATGGCAGGTCTATCAAT
TTTTGGGACAAGTCCCCTGAATGTCCTAATTGCATTGGTTTGCCTGAGGAAAGGTTGCTTGTACTTCATGGTCTTGCACAAGGTTTTGCTGTTATTACTA
TTTCAAGTGCAAGAACATGTTGGAGTTTTGGTAAGGAAGTGTTAGTTGTTAAAGACATTTTGGAGTGGTGGATTGGTAGAAGGAAGCTTGAGAAACTTCC
TCTTGTGGCTTTGGGTGCTTCATCTGGAGGGTATTTTGTATCTGTGCTTGCCACTGCTGTGAAATTTAATAGTATTGTAATCATGATTGCTGAGGGGATG
TTTGAGGAAATGGATGTTAAAGAGGACTACCCGCCTACCCTTTTTGTTCACATGCCTAAGGATCTTTATAGGCAGCAGAAAATAGATGAGTATGTAGAGG
TTTTGAAAGGTAAAGGGATTGATGTTGGTGTTGTTGAATGTATGGAGTTCCCATTGTCGCCGAACACGTTAGCTGATAGAATTCCAGGTCTTGATCTGAC
TCTTTCTAGAAGTTTATTTGAAATCTTTCAGGGAAAGGGCTTTGTTGATCAAAATGGATATATGCGGAAAGATGGACGTCGAATAAAATGGGAAAAGGCT
GTTGAGGAGAAGAAAACTCTTTCGCTGGATAAGCGTCTGGTCCCTCATATCCAGGAGGAGCTAAACCTTGCTTTTGCTTCCCATGAGATGACTAGCATCC
ATTCTGACCAGATTTTTAAATGGTTTGAATCTCATATGGGGTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
chr2.CM0099.18.1_at:992:1087TTTGGGTGCTTCATCTGGAGGGTAT9921087522Antisense
chr2.CM0099.18.1_at:729:843GGTATTTTGTATCTGTGCTTGCCAC729843542Antisense
chr2.CM0099.18.1_at:548:789GTGCTTGCCACTGCTGTGAAATTTA548789556Antisense
chr2.CM0099.18.1_at:577:679GATGTTAAAGAGGACTACCCGCCTA577679625Antisense
chr2.CM0099.18.1_at:482:89ATGTATGGAGTTCCCATTGTCGCCG48289750Antisense
chr2.CM0099.18.1_at:422:5ATTGTCGCCGAACACGTTAGCTGAT4225765Antisense
chr2.CM0099.18.1_at:297:839GGTCTTGATCTGACTCTTTCTAGAA297839799Antisense
chr2.CM0099.18.1_at:716:915TGGATAAGCGTCTGGTCCCTCATAT716915938Antisense
chr2.CM0099.18.1_at:228:861GGAGGAGCTAAACCTTGCTTTTGCT228861966Antisense
chr2.CM0099.18.1_at:530:1143TTGCTTTTGCTTCCCATGAGATGAC5301143980Antisense
chr2.CM0099.18.1_at:225:81ATGACTAGCATCCATTCTGACCAGA225811000Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At3g58800: unknown protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
chr2.CM0099.120.nc Lotus japonicus similar to At3g58800: unknown protein
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr2.CM0099.200.r2.m
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma14g03120.1|PACid:16294182 7e-164 572 5e-163 570
Medicago truncatula IMGA|Medtr5g091790.1 Mtr.37726.1.S1_at Link; 7e-160 559 1e-164 575
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC