Lotus japonicus Gene Expression Atlas
      Lj Gene Expression Atlas | Noble Foundation | Plant Biology 
 
     
Transcript Details

CAD31332.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>CAD31332.1_at
GTGATCGGGCCGACGGGTGTGGTCAAGGTGATGGTCGCGACGAAGCCGGTGGACTTCCGCAAGGGGGCCGAGGGCCTGGCGGCGCTGGTGCGCGAGACGA
TGGGCGCCGATCCGTTCTCTGGCGCGGTCTACGTCTTCAGGGCCAAGCGCGCCGACCGGGTCAAGCTGGTGTACTTCGACGGCACCGGCGTGTGCCTGCT
GGCGAAGCGTCTGGAAGACGGGAAGTTCTGCTGGCCTGCCATCACCGATGGCGTGGTGAGGTTGTCGGCGGCGCAATTGCAGGCGCTCCTGGAAGGGTTG
GATTGGCGGCGCGTGCATGACGCCCGCGAGACGCGCGCGCCGGTCGCGGCAAGTTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
CAD31332.1_at:218:1033TCAAGGTGATGGTCGCGACGAAGCC218103335Antisense
CAD31332.1_at:558:203ACGATGGGCGCCGATCCGTTCTCTG558203109Antisense
CAD31332.1_at:93:693GATCCGTTCTCTGGCGCGGTCTACG93693121Antisense
CAD31332.1_at:1138:837GGTCTACGTCTTCAGGGCCAAGCGC1138837138Antisense
CAD31332.1_at:1008:449CGGGTCAAGCTGGTGTACTTCGACG1008449169Antisense
CAD31332.1_at:274:297AAGCTGGTGTACTTCGACGGCACCG274297175Antisense
CAD31332.1_at:1114:785GTGCCTGCTGGCGAAGCGTCTGGAA1114785204Antisense
CAD31332.1_at:893:629GACGGGAAGTTCTGCTGGCCTGCCA893629229Antisense
CAD31332.1_at:455:435CTGCCATCACCGATGGCGTGGTGAG455435248Antisense
CAD31332.1_at:688:359AATTGCAGGCGCTCCTGGAAGGGTT688359287Antisense
CAD31332.1_at:665:573GAAGGGTTGGATTGGCGGCGCGTGC665573304Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Database error. No record found.
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
No gene mapped to this probeset using this criteria.Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© 2017 by The Samuel Roberts Noble Foundation, Inc.