Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

gi45616598_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>gi45616598_at
GAAGGAAGTAACCAAGTGGCTGTCCAATCTGGCTGCCAGGCCGATGGGAACCTGGGCATGGAGCCGTGTGAAGTGGAGGATCTGGAAACACCATGAATGA
TTGAATGATGCTGCTGAAGAATAAGTGGGTTGCCTGGTTTTGTGTGTGTGTTTCCCCCTTCGTTTGACCTTTTGAAATATTGTTGTCATTTGTGCCTCTA
CGAATGCAGCATCAGAATTTGTATCTAGAATTCTCANAATGTGATGCGAGTTGTACCTTCATTATATATAAAAGTTCTGTTTCTCTT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
gi45616598_at:922:877GGAAGTAACCAAGTGGCTGTCCAAT92287716Antisense
gi45616598_at:563:321AAGTGGCTGTCCAATCTGGCTGCCA56332126Antisense
gi45616598_at:208:345AATCTGGCTGCCAGGCCGATGGGAA20834538Antisense
gi45616598_at:864:807GTGGAGGATCTGGAAACACCATGAA86480785Antisense
gi45616598_at:979:515GCTGCTGAAGAATAAGTGGGTTGCC979515122Antisense
gi45616598_at:793:347AATAAGTGGGTTGCCTGGTTTTGTG793347132Antisense
gi45616598_at:111:983TGCCTGGTTTTGTGTGTGTGTTTCC111983143Antisense
gi45616598_at:501:413CTTCGTTTGACCTTTTGAAATATTG501413170Antisense
gi45616598_at:555:1085TATTGTTGTCATTTGTGCCTCTACG5551085190Antisense
gi45616598_at:969:785GTGCCTCTACGAATGCAGCATCAGA969785204Antisense
gi45616598_at:394:545GCAGCATCAGAATTTGTATCTAGAA394545218Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
BP059848 Lotus corniculatus var. japonicus mature nodule Lotus corniculatus var. japonicus cDNA clone GENf035e12 3 , mRNA sequence reverse complement
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
BP059848 Lotus corniculatus var. japonicus mature nodule Lotus corniculatus var. japonicus cDNA clone GENf035e12 3 , mRNA sequence reverse complement
Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC