Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_136660.1_s_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_136660.1_s_at
GTCGGTAAGGCTGAGTGGATTACCTATTTGGGGTCCTCCAATGTTGCCATCACTCTCCGAGCTGCGGCGATTATGCTGAAATTGGATAGTGGGTGGGATT
GGTTCATCACTTTGAGTGCACGTGATTATCCTCTCATCACTCAGGATGGTATGCCAATTTTGTCATTTCTGTTTGCTCCATGGATTTGTGTACCT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_136660.1_s_at:1137:939TGTTGCCATCACTCTCCGAGCTGCG113793954Antisense
Ljwgs_136660.1_s_at:515:35ATAGTGGGTGGGATTGGTTCATCAC5153598Antisense
Ljwgs_136660.1_s_at:1098:827GGGTGGGATTGGTTCATCACTTTGA1098827103Antisense
Ljwgs_136660.1_s_at:879:823GGGATTGGTTCATCACTTTGAGTGC879823107Antisense
Ljwgs_136660.1_s_at:637:847GGTTCATCACTTTGAGTGCACGTGA637847113Antisense
Ljwgs_136660.1_s_at:345:665GAGTGCACGTGATTATCCTCTCATC345665126Antisense
Ljwgs_136660.1_s_at:286:969TGCACGTGATTATCCTCTCATCACT286969129Antisense
Ljwgs_136660.1_s_at:1019:797GTGATTATCCTCTCATCACTCAGGA1019797134Antisense
Ljwgs_136660.1_s_at:519:989TCCTCTCATCACTCAGGATGGTATG519989141Antisense
Ljwgs_136660.1_s_at:925:47ATCACTCAGGATGGTATGCCAATTT92547148Antisense
Ljwgs_136660.1_s_at:593:1023TCAGGATGGTATGCCAATTTTGTCA5931023153Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At5g15050: unknown protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_136660.1 Lotus japonicus similar to At5g15050: unknown protein
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
LjSGA_013981.1
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC