Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_056336.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_056336.1_at
ATGGAGAATGCATATCCTGGCTCCAATATCTTAGTTGTGACAATAACAAATGGGGAATCAAAACGTGTGGAAGCTCAATCTGATGAAGATACCTTGAGGG
AGGCTATGGCAGTGCTCAGGGATATGTTTGGACCCGATATTCCGGACGCCATTGATATACTTGTTCCTCGCTGGTGGAATAACAGGTTTCAGCGTGGTAG
CTACAGCAACTACCCCATTATCTCCAATCGCAAAGTTTGCCGTAATATTAAGGTTAGCTTATCATTTTGGATTTTCTTATATTTTTATTGTTGTGACAAT
CTCCCCTTCATGTGCTCTGTTCTTAAAAAAAAT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_056336.1_at:809:647GAGAATGCATATCCTGGCTCCAATA80964716Antisense
Ljwgs_056336.1_at:185:67ATCCTGGCTCCAATATCTTAGTTGT1856726Antisense
Ljwgs_056336.1_at:138:261AAACGTGTGGAAGCTCAATCTGATG13826173Antisense
Ljwgs_056336.1_at:649:423CTATGGCAGTGCTCAGGGATATGTT649423116Antisense
Ljwgs_056336.1_at:141:21ATGTTTGGACCCGATATTCCGGACG14121136Antisense
Ljwgs_056336.1_at:1054:1137TTCCGGACGCCATTGATATACTTGT10541137152Antisense
Ljwgs_056336.1_at:204:31ATATACTTGTTCCTCGCTGGTGGAA20431167Antisense
Ljwgs_056336.1_at:496:349AATAACAGGTTTCAGCGTGGTAGCT496349190Antisense
Ljwgs_056336.1_at:1159:757GTAGCTACAGCAACTACCCCATTAT1159757209Antisense
Ljwgs_056336.1_at:616:197ACCCCATTATCTCCAATCGCAAAGT616197224Antisense
Ljwgs_056336.1_at:302:845GGTTAGCTTATCATTTTGGATTTTC302845264Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At5g13700: polyamine oxidase
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_056336.1 Lotus japonicus similar to At5g13700: polyamine oxidase
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr3.CM0451.450.r2.m
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma10g11700.1|PACid:16279269 0 751 0 759
Medicago truncatula IMGA|Medtr3g033000.1 Mtr.28830.1.S1_at Link; 0 827 0 805
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC