Lotus japonicus Gene Expression Atlas
      Lj Gene Expression Atlas | Noble Foundation | Plant Biology 
 
     
Transcript Details

Ljwgs_074539.1.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_074539.1.1_at
ATGACCCAGACCTGTTTCAACAAGTGTGTTGAGAACAGGTACAAGGAGTCTGAGCTAAATATGGGTGAAAATAGTTGCATTGACCGCTGTGTTTCAAAAT
ATTGGCATGTAAGATGTTGCTTATGTTCACTTTGGATGTGTCACTGTCATTTTTTCTACACTATTAGTCATTCTTTTTCCTCATATAGATTCAATTCTGG
TTGTTTTCCATGCTAA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_074539.1.1_at:628:353AATATTGGCATGTAAGATGTTGCTT628353110Antisense
Ljwgs_074539.1.1_at:341:149AGATGTTGCTTATGTTCACTTTGGA341149124Antisense
Ljwgs_074539.1.1_at:203:941TGTTGCTTATGTTCACTTTGGATGT203941127Antisense
Ljwgs_074539.1.1_at:1149:527GCTTATGTTCACTTTGGATGTGTCA1149527131Antisense
Ljwgs_074539.1.1_at:229:737GTTCACTTTGGATGTGTCACTGTCA229737137Antisense
Ljwgs_074539.1.1_at:379:381CACTTTGGATGTGTCACTGTCATTT379381140Antisense
Ljwgs_074539.1.1_at:617:859GGATGTGTCACTGTCATTTTTTCTA617859146Antisense
Ljwgs_074539.1.1_at:921:93ATGTGTCACTGTCATTTTTTCTACA92193148Antisense
Ljwgs_074539.1.1_at:699:769GTCACTGTCATTTTTTCTACACTAT699769152Antisense
Ljwgs_074539.1.1_at:1141:229ACACTATTAGTCATTCTTTTTCCTC1141229170Antisense
Ljwgs_074539.1.1_at:849:1083TATTAGTCATTCTTTTTCCTCATAT8491083174Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At2g29530: unknown protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_074539.1.1 Lotus japonicus similar to At2g29530: unknown protein
Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© 2017 by The Samuel Roberts Noble Foundation, Inc.