Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_020726.2.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_020726.2.1_at
CAGGCTCTATCTTCATACGTATTCATTGCAGCTAACGTCATTCTCCATTCATCTAAAGATGTTCAACCGAGGCATTTGGATGAATTGTTTCCTCCTTTAG
TTCCATTGTTAACATCACATCATCACAGCTTACGTGGTTTTACACAGTTACTAGTTTATCAAATTCTACATAAACTGTTTCCATTGTTGAATGATGGATC
TTCAGAGATACTACCTTTGGAGAAGAGGTGCCTTGTTGATTTGAAATTATACCTTGCAAGGAATTCTGATTGTGCACGGTATTGCTTTTATTTTTGTTCT
ATTTATATATATATTTTATCA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_020726.2.1_at:867:397CAGGCTCTATCTTCATACGTATTCA86739713Antisense
Ljwgs_020726.2.1_at:771:1125TTCATTGCAGCTAACGTCATTCTCC771112534Antisense
Ljwgs_020726.2.1_at:182:287AACGTCATTCTCCATTCATCTAAAG18228746Antisense
Ljwgs_020726.2.1_at:665:149AGATGTTCAACCGAGGCATTTGGAT66514969Antisense
Ljwgs_020726.2.1_at:804:685GATGAATTGTTTCCTCCTTTAGTTC80468591Antisense
Ljwgs_020726.2.1_at:665:987TCCTCCTTTAGTTCCATTGTTAACA665987102Antisense
Ljwgs_020726.2.1_at:542:277AACATCACATCATCACAGCTTACGT542277123Antisense
Ljwgs_020726.2.1_at:816:379CAGCTTACGTGGTTTTACACAGTTA816379138Antisense
Ljwgs_020726.2.1_at:765:697GATCTTCAGAGATACTACCTTTGGA765697209Antisense
Ljwgs_020726.2.1_at:315:311AAGAGGTGCCTTGTTGATTTGAAAT315311235Antisense
Ljwgs_020726.2.1_at:708:559GAATTCTGATTGTGCACGGTATTGC708559273Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At4g17610: putative protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_020726.2.1 Lotus japonicus similar to At4g17610: putative protein
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr4.CM2142.140.r2.a
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma17g15760.1|PACid:16305718 0 1241 0 1241
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC