Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

chr1.CM0029.27_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>chr1.CM0029.27_at
ATGGAACGACCTGGCCATGATTTTGCAGCTGCATCTGCTATGGCATATGCTCAGCAGCAGCGACCGCCGGCCGCGAATATGCAACAGCAGCAGCAGTTTG
GATTTCATCCCCAGCATCAGCAGTTTCCTTCATCAATCCATGGTCCTCCTTTTATGCCCCCAGGTCCCCCCTCCATGCAACAGTTCCCTTACCATCCCGC
CCTACAGCAACAGCAGCAGCAGCTTCAGCAGTTACATCCTCATGCCCCTCTGCCACCCCCTCATCTTCTTCAGCACCAAGCACCGCCTGCATTCCCCTCG
CATTATCCTCGTCCTCTTGTTTCATCGCCTTTTTTCGATTCTGCTCCACCCCCGGCTCCCCCGCCTTCTGACCCCGAGCTCCACAAGCGGATTGACAAAC
TTGTTGAGTATGCTGTGAAAAATGGCCCTGAGTTTGAAGCCATGATATGTGAAAAGCAACGAGATAATCCGGCCTATGGTTTCCTCTTTGGTGAGGAAGG
CCATGGTTACTACCGTTTTAAGCTTTGGTTGTCGAGCCATCCTCCGGGTGGTCCATTTAACCCAGCGTTTCAATCATCTTCCATGCCCATGATCCATCCT
CCTCCAAATCCAATGATTAGCCCATCACCTCTAAATGCTCCTCCAATGAATGCTGCTGCGTCTTCAATGCTAGGTCCGCCTCCTTTTCAGCAGTTTTATG
ATCAGCACCACCACCATCAGCATCCTCAGTCATTCGGGCTTCATGGTCGACCAGAGTATGACCAGTCATCCAAGTCTTTTAAAGGGCTCTCTGGGCCACT
TCCTTCTGATGTGGCAATGGAGCTCAGCAATGTTCTTGGCAATCTCACTGGTACAAAAGAATCCATCAAAAGTGCCAAGCTTTGGTTCATGCAGAGATCT
CCATTTGCACCAGCTCTTGCAGAGGCTCTTCGAGAGAGGGTCTTTGCATTGGATGACGTTGAGAGGCAGTTACATATAATATACCTTGCTAATGACATTC
TTTTTGACAGCTTAAATCGGAGGGCAAGCACTCATGATCTTGACAATGAGGCTCTTGCATTTAAACCTGTTTTAGGCTCCATGCTTGCAAGAATTTATCA
TAATCCACAAAGCAATGAGGAATATAGGAAAAGATTGCAGCAGATGGTGGAGTTCTGGTCTTCTAAAGAGGTATATGAGCAAAGAGACTATATCCTTAAT
GAAGGGTGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
chr1.CM0029.27_at:1017:335AATGATTAGCCCATCACCTCTAAAT1017335624Antisense
chr1.CM0029.27_at:728:339AATGCTCCTCCAATGAATGCTGCTG728339646Antisense
chr1.CM0029.27_at:647:339AATGCTGCTGCGTCTTCAATGCTAG647339661Antisense
chr1.CM0029.27_at:866:541GCAGTTTTATGATCAGCACCACCAC866541702Antisense
chr1.CM0029.27_at:696:11ATTCGGGCTTCATGGTCGACCAGAG69611744Antisense
chr1.CM0029.27_at:543:755GTATGACCAGTCATCCAAGTCTTTT543755768Antisense
chr1.CM0029.27_at:614:643GAGCTCAGCAATGTTCTTGGCAATC614643832Antisense
chr1.CM0029.27_at:279:487GCCAAGCTTTGGTTCATGCAGAGAT279487886Antisense
chr1.CM0029.27_at:500:27ATTTGCACCAGCTCTTGCAGAGGCT50027915Antisense
chr1.CM0029.27_at:947:1117TTAAACCTGTTTTAGGCTCCATGCT94711171073Antisense
chr1.CM0029.27_at:19:679GATGGTGGAGTTCTGGTCTTCTAAA196791155Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At4g31200: predicted protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
chr1.CM0029.220.nd Lotus japonicus similar to At4g31200: predicted protein
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr1.CM0029.1260.r2.d
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma12g23230.1|PACid:16288015 8e-144 506 4e-131 465
Medicago truncatula IMGA|Medtr1g092770.1 Mtr.11413.1.S1_at Link;Mtr.8486.1.S1_at Link; 8e-145 510 2e-156 548
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC