Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_034575.1_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_034575.1_at
AAGGTAGTTGTGCTTGGAGGGGGGTCGTTTGGGACCGCAATGGCTGCTCATGTTGCAAATAGAAAGGCTCAGCTAGAAGTCAACATGCTTGTTCGGGATC
CTCAAGTTTGCTTGTCAATCAATGAGAGACACTGCAATAGATCACACTCTGCCAGAAAACGTAGTTGCAACAACAGATGCGAAATCTGCTTTGCGTGATG
CAGATTACTGCCTTCATGCAGTGCCTGTTCAGTTCAGCTCAACTTTTCTCGAGAGCATTGCAGATTATGTTGATCCAGGTTTGCCTTTCATATCTCTCAG
TAAAGGCCTCGAGCTGAATACACTAAGGATGATGGCCCAAATTATTCCTCAAGCACTACGAAATCCTCGGCAGCCTTTTGTTGCACTGTCAGGGCCTTCG
TTTGCTCTCGAATTGATGAATAAGCTACCCACAGCGATGGTGGTGGCATCAAAAGACAAAAAATTGGCAAATAGAGTTCAGCAGCTCCTAGCTTCAAGTC
ATTTAAGAATAAGCACATCAAGGAGTTGAAATAGCAGGTGCACTCAAGAATGTGCTGGCAATAGCAGCAGGGATAGTGGTAGGCATGAATCTTGGTAACA
ACTCTATGGCTGCTCTTGTCTCGCAAGGTTGTTCAGAGATACGATGGCTTGCAACAAAGGTATTGACTGTAGATCGA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_034575.1_at:933:371CAACATGCTTGTTCGGGATCCTCAA93337193Antisense
Ljwgs_034575.1_at:959:821GGGATCCTCAAGTTTGCTTGTCAAT959821107Antisense
Ljwgs_034575.1_at:1150:147AGATGCGAAATCTGCTTTGCGTGAT1150147187Antisense
Ljwgs_034575.1_at:647:541GCAGTGCCTGTTCAGTTCAGCTCAA647541230Antisense
Ljwgs_034575.1_at:93:749GTTTGCCTTTCATATCTCTCAGTAA93749291Antisense
Ljwgs_034575.1_at:291:249AAAGGCCTCGAGCTGAATACACTAA291249314Antisense
Ljwgs_034575.1_at:946:675GATGGCCCAAATTATTCCTCAAGCA946675343Antisense
Ljwgs_034575.1_at:211:187AGCCTTTTGTTGCACTGTCAGGGCC211187384Antisense
Ljwgs_034575.1_at:1088:561GAATAAGCTACCCACAGCGATGGTG1088561430Antisense
Ljwgs_034575.1_at:786:545GCAGCTCCTAGCTTCAAGTCATTTA786545493Antisense
Ljwgs_034575.1_at:291:919TGGTAACAACTCTATGGCTGCTCTT291919605Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At2g40690: glycerol-3-phosphate dehydrogenase like protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
LjSGA_034575.1 Lotus japonicus similar to At2g40690: glycerol-3-phosphate dehydrogenase like protein
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
LjSGA_034575.1
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma02g38310.1|PACid:16249452 7e-63 237 8e-63 237
Medicago truncatula IMGA|Medtr5g067640.1 Mtr.13234.1.S1_at Link;Mtr.44438.1.S1_at Link; 9e-67 250 4e-67 250
GO annotations
Go TermGo Name
Search Link GO:0004367 GPD1 glycerol-3-phosphate dehydrogenase (NAD+)
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
BincodeDescription
1.3.10.1 Search E1.1.1.8, GPD1 glycerol-3-phosphate dehydrogenase (NAD+) [EC:1.1.1.8] [COG:COG0240] [GO:0004367]
1.3.10.2 Search E1.1.1.94, gpsA glycerol-3-phosphate dehydrogenase (NAD(P)+) [EC:1.1.1.94] [COG:COG0240]
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC