Lotus japonicus Gene Expression Atlas
      Lj Gene Expression Atlas | Noble Foundation | Plant Biology 
 
     
Transcript Details

Ljwgs_066033.1_s_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_066033.1_s_at
ATTCGAGGCTTGGCATGGCCTGCTTTACTTGTTGGATGGGTTGCTCAGAGTGCAAGTCTTGGCATGAAAGATTCTTGGGGACCCTTGAAGGCTTTGGCAG
CTGCTAGTGTTATAAATGGCATTGGTGATATAGTTTTGTGCATCTATTTAGGCTATGGAATTGCAGGAGCTGCATGGGCTACAATGGCATCACAAGTTGT
TGCTGCTTATATGATGATGCAAGCGCTAAACAAGAAGGGATATAATGCTTTTGCCTTCTCCATCCCTTCAGGAAAGGAACTTCTGATGATATTTCGCCTT
GCTGCTCCTGTATTTATGACAATGATGTCAAAGGTGGCTTTCTACTCACTACTTGTATATTTTGCTACATCAATGGGTACACATACAATGGCTGCTCATC
AGGTTAGTTTTGTTTCTGTGTCTCTGTTTCATGACTAT

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_066033.1_s_at:513:109AGGCTTTGGCAGCTGCTAGTGTTAT513109101Antisense
Ljwgs_066033.1_s_at:184:743GTTTTGTGCATCTATTTAGGCTATG184743145Antisense
Ljwgs_066033.1_s_at:846:1145TTGCAGGAGCTGCATGGGCTACAAT8461145173Antisense
Ljwgs_066033.1_s_at:181:971TGCATGGGCTACAATGGCATCACAA181971183Antisense
Ljwgs_066033.1_s_at:950:1107TTATATGATGATGCAAGCGCTAAAC9501107219Antisense
Ljwgs_066033.1_s_at:725:31ATATAATGCTTTTGCCTTCTCCATC72531252Antisense
Ljwgs_066033.1_s_at:109:413CTTCTCCATCCCTTCAGGAAAGGAA109413267Antisense
Ljwgs_066033.1_s_at:973:595GAACTTCTGATGATATTTCGCCTTG973595289Antisense
Ljwgs_066033.1_s_at:884:85ATGATATTTCGCCTTGCTGCTCCTG88485298Antisense
Ljwgs_066033.1_s_at:21:893GGCTTTCTACTCACTACTTGTATAT21893348Antisense
Ljwgs_066033.1_s_at:481:1047TACACATACAATGGCTGCTCATCAG4811047390Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to At2g21340: unknown protein
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
chr3.CM0216.670.nc Lotus japonicus similar to At2g21340: unknown protein
Mapping probesets to CDs Version 2.5 ( Strategy )
Gene IDDescription
chr3.CM0091.1800.r2.m
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
SpeciesGene IDTranscript DescriptionE-Value (Others->Lj)Bit Score (Others->Lj)E-Value (Lj->Others)Bit Score (Lj->Others)
Glycine max Glyma11g11990.1|PACid:16283580 0 785 0 779
Medicago truncatula IMGA|Medtr4g071370.1 Mtr.10099.1.S1_s_at Link;Mtr.2195.1.S1_at Link;Mtr.25877.1.S1_s_at Link;Mtr.25878.1.S1_at Link;Mtr.50012.1.S1_at Link; 0 832 0 832
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
Family: The Multidrug/Oligosaccharidyl-lipid/Polysaccharide (MOP) Flippase Superfamily
 
         
       
© 2017 by The Samuel Roberts Noble Foundation, Inc.