Noble Research Institute, LLC   Noble Research Institute | Lotus japonicus Gene Expression Atlas  
      Lotus japonicus Gene Expression Atlas  
 
     
Transcript Details

Ljwgs_147043.1_x_at Printer-friendly Version
Expression profile    (Problem seeing the expression profile below? Get flash player.)


Add to Multi-transcript Viewer (MTV)    Customize slides (experiments / samples)    View co-expressed transcripts
Consensus, target, and probe sequences: ( How to interprete )
>Ljwgs_147043.1_x_at
TGCTGCTGTACTAAATAAGAAGGAAGGAAAGAAGAAAAATTTGCATTCCCAGACAAGATCTTTGAAGTGGAAGAAAGTTTCTGTTAATGATTCAGAGACA
AATGTTGAACCAGATGTGCAGAACATTGTGCCCACTGCTAGAAAACAGATAAGAGGCAAGGGAATTCCTGTTAATGTTCCCCCTGCTCCTCTGGATAATG
TGTCATTCCATCCTGAAGCAAATGTTCAGACGTGGAAATCTGTGTGTCAGGAAAAGATTGCCTGTGAGAAAGAGTGTAGTCAAGAAGCTATGGAGTGCAA
GGATATCATGGACTTTCTTGCTGATGTTGGGTTGTCA

Chip and genome coordinates:
Probe IDProbe SequenceChip XChip YInterrogation PositionTarget Strand
Ljwgs_147043.1_x_at:221:977TGCTGCTGTACTAAATAAGAAGGAA22197713Antisense
Ljwgs_147043.1_x_at:440:515GCTGCTGTACTAAATAAGAAGGAAG44051514Antisense
Ljwgs_147043.1_x_at:930:165AGAAGAAAAATTTGCATTCCCAGAC93016542Antisense
Ljwgs_147043.1_x_at:147:581GAAGAAAAATTTGCATTCCCAGACA14758143Antisense
Ljwgs_147043.1_x_at:25:305AAGAAAAATTTGCATTCCCAGACAA2530544Antisense
Ljwgs_147043.1_x_at:57:163AGAAAAATTTGCATTCCCAGACAAG5716345Antisense
Ljwgs_147043.1_x_at:73:603GAAAAATTTGCATTCCCAGACAAGA7360346Antisense
Ljwgs_147043.1_x_at:7:265AAAAATTTGCATTCCCAGACAAGAT726547Antisense
Ljwgs_147043.1_x_at:876:1143TTGCATTCCCAGACAAGATCTTTGA876114353Antisense
Ljwgs_147043.1_x_at:326:303AAGCAAATGTTCAGACGTGGAAATC326303228Antisense
Ljwgs_147043.1_x_at:932:629GACGTGGAAATCTGTGTGTCAGGAA932629241Antisense
Probes are not mapped to Mt genome as they do not target a Mt gene. Launch Genome Browser Launch the Mt genome browser anyway.
Initial annotation during chip design
Lotus japonicus similar to O64406: (O64406) ENVELOPE-LIKE PROTEIN (FRAGMENT)
Representative public ID:
Gene (re)mapping & annotations
Mapping probeset to CDS ( Strategy )
Gene IDDescription
chr5.LjT42F22.150.nc Lotus japonicus similar to O64406: (O64406) ENVELOPE-LIKE PROTEIN (FRAGMENT)
Mapping probesets to CDs Version 2.5 ( Strategy )
No gene mapped to this probeset using this criteria.
Legume specific gene
Based on BLAST searches, this transcript is not legume specific.
Putative Orthologs (reciporocal best BLAST hits)
No information available.
GO annotations
No information available
Protein domains
No information available
KEGG annotations based on the GeneBins database Link
No information available.
Biological pathways
Based on the MedicCyc database Link, this transcript is not involved in a known biological pathway for the time being.
Transcription factor prediction and categorization
No information available (not predicted as a transcription factor)
Membrane transporter prediction and categorization
No information available (not predicted as a transcription factor)
 
         
       
© Noble Research Institute, LLC